Руководство по генетике: различия между версиями

Материал из SS220 /tg/station13 (Space Station 13)
Перейти к навигации Перейти к поиску
imported>Prometheos2
м (→‎List of Mutations: Correct previous info on ST (to confirm).)
 
м (Ronstruben переименовал страницу Guide to genetics в Руководство по генетике: Перевод названия страницы)
(нет различий)

Версия от 10:52, 17 декабря 2021

Geneticist.png
Ruth McVork говорит:
«Welcome to genetics, brother! Are you feeling good? You SHOULD feel good! You are now like unto a tiny god! Are you prepared to be what you were born to be? Are you ready to save the station (or totally fuck it up)? Chin up, buddy. It's not that hard. But before you start grabbing those monkeys from the pen, you should know the basics.»


The Department

Genetics.png

Welcome to Genetics.

This room has two DNA Scanners and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later.

A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all be worth it.


Scanner.gifMedcom.gifClone.gif Cloning

Cloning was removed from the game in Jan, 2020. This is only for historical reference.

Expand for the old guide to cloning.

For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.

  1. First of all, you have to know that for all things cloning, the Chief Medical Officer has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
  2. On to the specifics! How to clone: Just grab or pull a body and stuff it into the DNA Scanner and close the door. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out.
    This is the cloning console menu.
  3. When the Scanner is occupied, interact with the Cloning Console. You will see a few options. The most important one is "scan". Click it. If they can be cloned, scanning will succeed regardless of whether they're in their body or not. There are several possible errors that can happen when you try to scan. See the ssection about cloning errors for details.
  4. If scanning is successful, you will get a Successful Scan -message. That means you now have that person's cloning data saved. You can use this record to steal their genetic data at any time, but cloning is more limited - if their last death happened after they got scanned, any attempts to clone using the scanned record will fail.
    This is what you see after clicking "View Records".
  5. After you actually have DNA data from a person, click Check Records, and then click View Record of the person who you want to clone. You will see a list of their UI(Unique Identifiers) and their SEs (Structural Enzymes). These can be copied and pasted with a cloning data disk (see one of the images to the right). Click Clone. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now take the old corpse out of the DNA Scanner, strip it completely so the cloned person can have their stuff back, and place the old corpse inside a body bag in the morgue. You don't have to worry about the old corpse anymore.
    This is what can you see after clicking a specific "View Record" under "View Records". If you have an ID with cloning access you can delete a record. Otherwise it will say "access denied" when trying to delete it. If you have inserted a "cloning data disk" you have additional options to save or load UE, UI and SE (dormant mutations) to and from that disk.
  6. The cloning process takes about 2 or 3 minutes depending on upgrades. For whoever is getting cloned, it may feel like a very long time. While the person is getting their new body formed, take their belongings and stuff them all into a locker, so they're not scattered all over or stolen. Cloning the captain and leaving their ID or other secure items on the floor is bad.
    • Aborted cloning: Use this as traitor to screw with that assistant who talked smack to you earlier. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject. This will usually clone people without limbs or vital organs, making them die quickly.
  7. The cloned people often have cellular damage. If so, take them to cryo to fix it.
  8. After the pod is empty, feel free to clone your next patient, and to let the old one out, since they most likely don't have clearance to open the door.
  9. If R&D has been doing their job, they might upgrade the cloner to a level where it can autoprocess. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan and clone automatically. This is useful to process a large pile of bodies quickly. Scan them one at a time, and autoprocess will do the rest.

OH GOD OH FUCK Hark! A Husk!

So you've come across a husk (a grey corpse) on your floor, which means you can't clone that poor sod without upgrades. Before you go throwing that body in the morgue, they can still be helped!

  1. First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says Subject no longer contains the fundamental materials required to create a living clone, then you have yourself a husk (if your DNA Scanner had been updated to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
  2. Take the body down to Surgery.
  3. Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
  4. Put the brain in the DNA scanner like you would a body.

Optionally a husk can be unhusked with rezadone. If all goes well then your cadaver will be reborn.

Changeling Victims

If examining the husk shows "He/she is limp and unresponsive; there are no signs of life... " it means the body has a soul online. If the corpse still can't be scanned in fully upgraded cloning, it's possible it was someone who got absorbed by a changeling. There appears to be no easy way to revive absorbed victims. Not even through brain transplants.

Helping the Headless

Sometimes you'll find a corpse whose head is separated from their body. Thanks to the marvels of modern science, this is not a problem!

  1. If you have a head or a brain, just chuck it into the cloner as normal. This may require the DNA scanner to be upgraded though. To clone a head or brain you must throw it into the DNA Scanner by activating throw with R and then clicking it, or by walking into the DNA scanner and dropping the head/brain. Then click the cloner to close it.
  2. If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!
  3. If you have neither, he's dead for good.

Cloning Plasmamen

If the patient is a plasmaman, cloning them will be complicated by the fact that the naked patient will burn in the station's atmosphere. This can be dealt with by using showers to keep the patient from catching fire, then dressing them in a plasma envirosuit.

  1. Put plasmaman into cloning scanner
  2. Scan them, start the cloning process
  3. Drag their dead body to cloning pod
  4. Undress them and leave their clothes in a pile
  5. Turn on shower near cloning pod
  6. Once they pop out of cloner, put them under shower and wait for them to dress up

If the patient is a naked or beheaded plasmaman, follow these additional steps:

  1. Once they pop out of cloner, put them under shower and feed them a few Salbutamol pills (if available), or if desperate, keep a syringe of Perfluorodecalin ready in case you need it. Plasmamen suffocate if they don't have plasma to breathe!
  2. Yell at cargo to order plasmaman supplies. In the meantime, bug Engineering/Atmos for a filled plasma tank.

Empty Cloning

Cloners have the option to "Empty Clone" a record, creating a mindless replica of a person. To complement this function, cloners can do Body-Only scans, which can only be used to create empty clones but not real clones, and bypass the sentience restrictions that ordinary scans have. These body-only entries can be deleted without requiring access.

Cloning Errors

Error message Cause Solution
Unable to locate valid genetic data. Whatever you put inside the scanner doesn't have valid (humanoid) DNA. Stop putting bees in the scanner.
Subject's brain is not responding to scanning stimuli. The person inside has suicided or signed an infernal contract. Cloning is impossible. Let the Cook take care of them or put the body in the morgue.
Subject no longer contains the fundamental materials required to create a living clone. You're trying to scan a body that's been husked or smashed by megafauna, but your scanner doesn't have a (tri-)phasic scanning module. Remove the brain and scan it. Yell at RnD to upgrade your scanner.
Mental interface failure. The corpse has no ghost associated with it. Try again in a few seconds - ghosts get notified when someone attempts to scan their body. No success? Let the Cook handle it.
Subject already in database. That person has already been scanned. Start the cloning process. Want to update the current clone scan? The CMO can delete scan files.
Initialisation failure. The patient is still alive. Try again when the patient is dead.
Unable to initiate cloning cycle. Cloning has been disabled in the server config. Yell at admins and hand the corpse over to the Chef.
Corpse has no head. Some asshole decapitated your guy - clone scanning is impossible without a brain. Draw a blood sample and ask Botany to clone them with the Replica Pod plant. Can't draw blood either? Your patient is out of luck.

Keep in mind that patching up a corpse with Synthflesh and then reviving it with Strange Reagent bypasses a lot of these issues.

Scanner.gifMedcom.gif DNA Modification

This is the "Enzymes" tab. The "Radiation Emitter" function may randomize certain individual cosmetic features of the person inside, as well as irradiate them. This menu can be used to transfer identities between people, but it can't be used to change a person's species. This information can also be stored on cloning data disks.. Regarding the genetic research, listen to the direct orders of the Research Director as well as the Captain

.

Now, let's get you acquainted with the DNA Scanner Access Console. It has a few things of note. First you need to learn some terms:

Unique Enzymes

  • Unique Enzymes (UE) = Your name. Even if you mutate the UE it will have no effect on the name. What you can do however, is to transfer UE from one person to another, copying their name.

Unique Identifiers

  • Unique Identifiers (UI) = Your cosmetic details - eye color, skin color, hair style, hair color and gender.

In the DNA scanner access console there is a tab named "Enzymes". This tab can be used to copy UE and UI between people.

  • Click "Save" to save a person's UE + UI to the console. You can not save mutations this way (anymore).
  • Click "Transfer" to copy the genes of the buffer to whoever is inside the scanner. You can choose between Enzymes (UE), Identity (UI) and Full Makeup (UE+UI).
  • Click "Transfer (Delayed)" to copy the genes of the buffer to the next person who steps into the scanner and closes it (such as yourself). This option is only available if the scanner is empty.
  • Click "Print" to print a DNA injector containing the genes of the saved buffer. Injecting this into a person will transfer the UE, UI or UE+UI to that person. Unlike mutation injectors and activators however, these DNA injectors are not permanent, and will only last for a short while after injected.

Structural Enzymes

  • Structural Enzymes (SE) / Genetic Sequence = Your mutations. They contain data relevant to your genetic structure. This governs your race and mutations. The term "Structural Enzymes" is no longer used by the DNA scanner access console since it was replaced with "Genetic Sequence" (which is the same thing), but the term may still show up elsewhere.

Genetic Sequencer

This is what the Sequencer tab may look like with a human in the scanner.

In the DNA scanner access console there is a tab named "Sequencer". Here you will alter genes to find mutations. There are four types of blocks: A, T, C and G. Each pair of letters in the boxes are connected. A goes with T, and G goes with C. Order does not matter. Each pair has a correct combination of "AT, TG, CG or GC" that needs to be filled. If you see a an unmodified pair be X-T it means the right combination of that pair is A-T. When all 16 pairs have the right blocks, the mutation will activate and you will be able to store it. Monkeys can only have the "monkified" mutation unless humanized. Once you have found the name of a mutation, that mutation will be permanently identified in all DNA scanner access consoles.

You might want to disable the monkey mutation by replacing one of the healthy pairs with annother letter. How to do all this will be detailed in the guide below.

Gene scanner.gif Genetic Sequence Scanner

What it looks like after clicking someone with the "Genetic Sequence Scanner" item, and then using the Genetic Sequence Scanner in hand and selecting "Mutation 39". Note that we now know that the first pair should be C-G.

The more difficult mutations will have a lot of unknown (X-X) pairs. You cannot just randomly enter A-T, since it's predetermined what it's supposed to be. Knowing all this, you could whip out the genetic sequence scanner Gene scanner.gif from your pocket. If you're looking for the correct pairs of mutation 39, scan people until you find a person with mutation 39. Then use the scanner in your hand for a menu to pop up. In the menu, select "mutation 39". This gives you a reading which will likely give you more information about which pairs you need to finish mutation 39.

What it looks like after correctly filling all pairs. Mutation 39 turned out to be "Monkified". Since solving a mutation activates it, the subject in the scanner is now a monkey.


You can use your Genetic Sequence Scanner Gene scanner.gif on a DNA scanner access console to permanently synch the item, which makes you see the names of discovered mutations when scanning people with it.

More info about some of the other tabs can be found in the guide further below.

Hulk.png List of Mutations

Before we start splicing, you must know what possible monstrosities can be done to a human.

Mutation Name Description Indicators Message How/Where to Obtain Instability
Telekinesis This power allows the subject to control things with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal. To use it, switch to an empty hand and click on an object (note that, if they can, your character/the game will prioritize picking up an object normally over picking it up telekinetically). A circle symbol will appear underneath the object and in your hand and you can now control the object. You can also use any console from a distance. Appears as a blue glow around the subject's head. "You feel smarter" Genetic 30
Hulk Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. The subject is also immune to stuns and slowdowns from stamina and normal damage, and cannot be pushed past. Breaking walls and machinery deals heavy brute damage to your arm. This mutation is lost when the subject falls to critical health. Created by combining Strength with Radioactive.
  • Can swing people by their tails. To do this, get your tailed victim in at least a neck grab (lvl 3 grab), enable throw mode, then click in the direction you want to throw.
  • Makes you extra vulnerable to cold and take brute damage from it.
Subject turns green and has red eyes. "Your muscles hurt." Radioactive + Strength 40
Space Adaptation This makes the subject resistant to cold and lack of pressure, effectively allowing it to survive in space (they still have to wear internals, however). This will not make them immune to fire. Subject has a pulsating orange-blueish "aura". "Your body feels warm." Genetic 30
Thermal Vision The user of this genome can visually perceive people's unique thermal signatures, even through walls and in darkness. "You can see the heat rising off of your skin..." Genetic 25
X-Ray Vision The X-Ray mutation was removed in June, 2020. Admin spawn only. Basically it gives the subject the ability to see everything that is beyond their normal vision: walls, furniture, even other people! This, combined with Telekinesis, is a deadly combination. Created by combining Thermal Vision with Radioactive. Subject's eyes "glow eerily" if looked at with a penlight. "The walls suddenly disappear." Thermal Vision + Radioactive 35
Chameleon The subject becomes able to subtly alter light patterns to become invisible, as long as they remain still. Subject starts fading into the background. "You feel one with your surroundings." Genetic 25
Dwarfism Turns the subject into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping. Subject looks smaller. "Everything around you seems to grow.." Human Species 5
Nearsightedness Makes the subject's screen go hazy at about halfway from the edge of your whole vision. It's not THAT bad, and can be temporarily fixed by using prescription glasses. \ "Your eyes feel strange." Genetic
Epilepsy Subject starts to fall down and keeps shaking all the time. Subject falls down. "You get a headache." Genetic
Coughing Makes the subject drop small items you're holding, like syringes. Pretty harmless, but has potential to be extremely annyoing. Subject coughs. "You start coughing." Genetic
Tourette's Syndrome The subject swears all the time. They may also experience paralysis that takes even longer than the seizures. Avoid. Subject curses out loudly and twitches. "You twitch." Genetic
Nervousness Makes the subject stammer. Annoying at best. Subject stammers when they speak. "You feel nervous." Genetic
Blindness Subject goes completely blind, becoming a part of a usually forgotten minority. How sad. Subject's eyes don't react to penlight. "You can't seem to see anything." Genetic
Deafness Makes the subject deaf. Harmless at best, annoying at worst. You just don't hear anything, not even yourself. \ "You can't seem to hear anything..." Genetic
Clumsiness Subject has a clown-like clumsiness. For those that have always wanted to be clowns. It makes the subject accidentally drop things they hold, unable to use tasers, handcuffs, guns exploding in their face etc. \ "You feel lightheaded." Genetic/Clowns
Unintelligible Heavily corrupts the part of the brain responsible for forming spoken sentences, causing the subject to only be able to speak short sentences. \ "You can't seem to form any coherent thoughts!" Genetic
Mute Completely shuts down the speech center of the subject's brain. \ "You feel unable to express yourself at all." Genetic
Wacky Forces the subject to talk in an odd manner. \ "You feel an off sensation in your voicebox." Genetic
Glowy Gives the subject a faint glow. Subject glows. "Your skin begins to glow softly." Genetic 5
Anti-Glow Makes the subject delete light in a radius around it. Subject has an aura of darkness. "Your skin seems to attract and absorb nearby light creating 'darkness' around you." Glowy + Void Magnet 5
Strength Subject feels stronger, but isn't. Combine with Radioactive to make the Hulk power. "You feel stronger" Genetic
Fire Sweat Subject sweats liquid fire[CITATION NEEDED] and grows slightly more resistent to fire[CITATION ALSO NEEDED] Subject will spontaneously combust "You feel hot." Genetic
Void Magnet You have the power to make yourself mostly invincible for a brief period at the cost of being unable to move. You will also enter this state randomly and against your will. A rare genome that attracts odd forces not usually observed. "You feel a heavy, dull force just beyond the walls watching you." Genetic 30
Radioactive Subject radiates energy from their skin. They're just as susceptible to it as anyone else Subject glows with a green aura "You feel it in your bones" Genetic 5
Telepathy Subject is able to broadcast it's thought directly to others A rare mutation that allows the user to telepathically communicate to others. "You hear your thoughts echo in your mind" Genetic 10
Firebreath Subject becomes able to breathe concentrated balls of fire. An ancient mutation that gives lizards breath of fire. "You feel a heat built up in your throat" Lizard Species 30
Smile Causes the speech center of the subject's brain to produce large amounts of seratonin and a chemical resembling ecstacy when engaged. Removed in April 2020 for replacing some words disliked by Github. \ "You feel so happy. Nothing can be wrong with anything. :)" Genetic
Chav Forces the language center of the subject's brain to construct sentences in a more rudimentary manner. \ "Ye feel like a reet prat like, innit?" Genetic
Swedish Forces the language center of the subject's brain to construct sentences in a vaguely norse manner. \ "You feel Swedish, however that works." Genetic
Elvis Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll. A terrifying mutation named after its 'patient-zero'. "You feel pretty good, honeydoll." No longer in Genetics, but can be acquired via admin spawned injector
Medieval Forces the language center and primary motor cortex of the subject's brain to talk and act like a knight on a quest for the Holy Grail. A mutation forcing people to make references to Morty Python and the Holy Grail. "You feel like seeking the holy grail!." Genetic
Unstable DNA Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one. Strange mutation that causes the holder to randomly mutate. "You feel strange." No longer in Genetics, but can be acquired via admin spawned injector
Insulated This makes you shock resistant, not unlike wearing a pair of insulated gloves. The affected person does not conduct electricity. "Your fingertips go numb." Genetic 25
Shock Touch This gives you a power that charges your hand with electricity. Use it on somebody to give them a good shock, which will do burn damage and large amounts of jittering and confusion. [to confirm] Protects you from shock while activated. The affected can channel excess electricity through their hands without shocking themselves, allowing them to shock others. "You feel power flow through your hands." Insulated + Radioactive 30
Transcendent Olfaction This power lets you track people by scent. Hold something in your hand and use the power to look for a scent on it. Use the power without holding anything and you'll track the scent you previously found. Your sense of smell is comparable to that of a canine. "Smells begin to make more sense..." Genetic 30
Geladikinesis Allows the user to concentrate moisture and sub-zero forces into snow This mutation lets you create snow, used to build snowtiles, walls, balls and snowmen "Your hands feel cold" Genetic 10
Cryokinesis Draws negative energy from the sub-zero void to freeze surrounding temperatures at subject's will Lets the user shoot a bolt of cryokinesis to freeze people, objects and tiles "Your hands feel cold" Genetic 20
Antenna The Affected person sprouts an antenna. This is known to allow them to access common radio channels passively. An antenna is visible on the user's head, and they basically have a built in station-bounced radio. "You feel an antenna sprout from your forehead." Genetic 5
Mind Reader The affected person can look into the recent memories of others. An antenna is visible on the user's head, and they can read the minds of others. This will reveal the name of the target and some snippets of what the target has said in the past. Tin foil is known to block this power. "You hear distant voices at the corners of your mind." Antenna + Paranoia 40
Spatial Instability The victim of the mutation has a very weak link to spatial reality, and may be displaced. Often causes extreme nausea. Victim randomly teleports a short distance away and becomes extremely disgusted as a result. "The space around you twists sickeningly." Genetic 10
Paranoia Subject is easily terrified, and may suffer from hallucinations. Subject screams frequently "You feel screams echo through your mind..." Genetic
Gigantism The cells within the subject spread out to cover more area, making them appear larger. Subject is slightly larger than normal "Everything around you seems to shrink.." Genetic
Two Left Feet A mutation that replaces the right foot with another left foot. Symptoms include kissing the floor when taking a step. Subject is randomly knocked down. "Your right foot feels... left." Genetic
Autonomy Allows a creature to voluntarily discard a random limb, to help it escape from predators. \ "Your joints feel loose." Genetic 30
Tongue Spike Allows a creature to voluntary shoot their tongue out as a deadly weapon. The tongue does not grow back. \ "Your feel like you can throw your voice." Genetic 15
Stimmed The user's chemical balance is more robust. (Does nothing.) \ "You feel stimmed." Genetic
Chem Spike Allows a creature to voluntary shoot their tongue out as biomass, allowing a long range transfer of chemicals. The tongue does not grow back. \ "Your feel like you can really connect with people by throwing your voice." Tongue Spike + Stimmed 15
Webbing Production Allows the user to lay webbing, and travel through it. User will grow psychologically attached to laying webs if used enough. \ "Your skin feels webby." Genetic 15
Internal Martyrdom A mutation that makes the body destruct when near death. Not damaging to others, but very, VERY disorienting. Subject explodes in a bloody shower when in deep crit. "You get an intense feeling of heartburn." Strong + Stimmed
H.A.R.S. A mutation that makes the body reject the head. Stands for Head Allergic Rejection Syndrome. Warning: Removing this mutation is very dangerous, though it will regenerate head organs. Subject loses their head, including eyes, ears, tongue etc. "Something feels off." Genetic
Fiery Sweat A mutation which causes the victim to light into flames. Subject will randomly light on fire. / Genetic

Guide to finding and using mutations

This guide here shows you step by step how to find the powers from the mysterious blocks!

First Steps

This guide will start with using a monkey, because they're in the pen for a reason.

  • Start by taking a monkey from the pen.
  • Shove it into a DNA Scanner next to the pen, by click dragging.
  • Check the console next to it, you'll see a bunch of options. Find Genetic Sequencer.

All mutations are randomized every round.

Humanizing a Monkey

Always humanize your monkey first, or their powers wont work or be savable.

  1. You and your geneticist buddy automatically share the mutations you've discovered, so work togheter to discover them all.
  2. Click through the mutations and find "Monkified". Then break a random pair by changing a letter to X.
  3. When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person!
  4. Mutadone will also clear the "monkified" mutation from monkeys, instantly turning them human. Use a dropper set to 1u to squirt the dissolved mutadone into the eyes of monkeys to mass humanize them without needing any machinery. This will not make you "discover" the monkified mutation however.
  5. If for any reason you got yourself some bad mutations and have no one to remove them, grab the mutadone pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of mutadone into it and take a sip. It should instantly clear all your mutations.

Manifesting Mutations

Back to business! Now we'll try to make a mutation show itself to us:

  1. Find a mutation that has broken pairs.
  2. Start filling in the X's. This is fairly easy since most of them are connected to an A, T, G or C. So X-T would be A-T.
  3. You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG.
  4. If there's more than 2 double X-pairs, consider using the JOKER option when editing a letter, which finds the correct letter for you (on a long cooldown), or going out and scanning some people and see if they have the missing pairs (as described above).
  5. If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or scramble their DNA.

Scramble DNA

Clicking the Scramble DNA button will blast the subject with radiation, and randomize which discoverable mutations it has.


DNA Injector.png Activators and Injectors

After manifesting a mutation in the Genetic Sequencer tab, hit store to save it to the "Storage - Mutations" tab. You can print activators and injectors from both the Sequencer and the Storage - Mutations tab.

  • Activators: An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a Genetic Sequence Scanner Gene scanner.gif. For example, since all humans have the "monkified" mutation dormant in them, a "monkified" activator will always work on humans. Using an activator will not increase genetic instability. Used activators can be recycled into the DNA scanner access console to produce chromosomes.
  • Injectors: An injector will permanently manifest a mutation in a person, regardless of if that person has that mutation dormant or not. This may cause genetic instability.


The DNA Scanner Access Console takes time to recharge after producing an activator or injector. The activator has a much shorter cooldown.

DNA Injector.png Advanced Injectors

This is the "Adv. Injectors" tab.

After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 instability or 10 mutations. Unlike activators or ordinary injectors, these can be named anything you want. To create an advanced injector, do the following:

  1. Go to either the "Storage - Adv. Injectors" tab. Click "Create new injector" and choose a name to crate a new slot for mutations to be stored in.
  2. Go to the Sequencer tab or the "Storage - Mutations" tab and click on a stored or discovered and active mutation.
  3. Click "Add to advanced injector". Select the name of the slot you made in step 1. Repeat with any other mutations you wish to save to the same advanced injector.
  4. Go back to the "Adv. Injectors". Click Print. You will print an injector with named "Advanced (name) injector".

Genetic Instability

When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to 99 genetic instability before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic breakdown is random and unpredictable. Negative mutations generally don't give you instability, but powers do. As a rule of thumb, the stronger the power, the more instability it gives. Choose your powers wisely.


Chromosome 21

Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console for a 60% chance to gain a random chromosome. The chromosome gets stored in the "Storage - Chromosomes" tab. Clicking on a chromosome gives you information about it. You can also eject it into its physical form. Physical chromosomes can only be used by inserting them into a DNA console.

Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the Sequencer tab. Then click an activated mutation, or find one if none is active yet. You should see the line Select a chromosome followed by a list of chromosomes that mutation would be compatible with. Select a chromosome in the dropdown menu and you have now filled that mutation's chromosome slot. To delete the chromosome from a mutation you need to deactivate and reactivate the mutation by changing any letter and then back.

After you have added a chromosome to a mutation, you can store it to the Storage - mutations tab as normal (by clicking Save to console in the Sequencer tab). Mutations from mutators/activators printed from this stored entry will then contain that chromosome.

These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis):

  • Synchronizer (5/19): Gives the mind more control over the mutation, reducing some downsides by 50%.
  • Stabilizer (1/19): The rarest chromosome. Reduces instability gained from the mutation by 20%.
  • Power (5/19): Boosts strength of certain mutations. Experiment with super sneeze or even deadlier fireballs!
  • Energetic (5/19): Reduces cooldown on action based mutations.
  • Reinforcement (3/19): Makes the mutation immune to mutadone. Removed Aug 2020.

Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation.

What to do with your powers

  • Export your best powers to a disk, as a backup. There's always the risk of an AI or someone else deleting them for any reason.
  • Make injectors to give to the greytideheads of staff or security. You can also sell them for money!
  • Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense.
    Note: Admins have confirmed that if people inject themselves with a needle they found lying around that says "Godhood" on it without even asking what is in it, you will NOT get punished for turning them into monkeys. Just make sure to answer truthfully if asked, and not to inject it yourself.
  • Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals.

Against the Radiation

Sometimes your subjects may get irradiated by your experiments.

  • At some point it may be a good idea to visit Chemistry or the medivent, and get some Potassium Iodide for your genetic testing. It's a very useful chem, as it lowers low radiation levels quickly.
  • Pentetic Acid works very well against both rads and toxin damage.


CRISPR Editing

This allows you to swap out base mutations in a targeted way. Base mutations don't suffer from instability

Getting a CRISPR Charge

First, you'll need to collect a CRISPR charge. This is a sample of a virus with genetic abilities you can use to swap out base mutations.

  • Get the Viro to make a virus with either Dormant DNA Activator or Viral Evolutionary Acceleration (Ideally otherwise benign)
  • Have a containment protocol, get yourself scanned for diseases if you get symptoms, hope the cure is available if things go south
  • Infect a contained monkey, use an Activator (not a Mutator) on it - it collects the charge when it collects chromosomes
  • Feed the used activator to the console to add the charge to the console


Using a CRISPR Charge

You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow:

  • Solve the mutation you want or just use a mutator on a humanized monkey
  • Take note of the top row
  • On the subject you want to swap mutations on, solve the mutation you want to swap
  • Use a CRISPR charge on it
  • Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation
Building the CRISPR String

For example, let's say Epilepsy is

  • A T T A C G C G A T T A C G C G
  • T A A T G C G C T A A T G C G C

And Telekinesis is

  • A T A T C C G G A T T A C C G G
  • T A T A G G C C T A A T G G C C

Take note of the first row of both

  • Epilepsy is A T T A C G C G A T T A C G C G
  • Telekinesis is A T A T C C G G A T T A C C G G

You then need to weave these rows together, old-new-old-new-old-new like this:

  • _A T A T C C G G A T T A C C G G :NEW (Telekinesis)
  • AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String
  • A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)

Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps Epilepsy out for Telekinesis

  • AATTTAATCCGCCGGGAATTTTAACCGCCGGG

If your string is not the right length, nothing happens, but if the string is wrong, you may end up with a Acid Flesh instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back. Also the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly.



Congratulations. If you read everything is this guide, you should now be a full-fledged Geneticist.

The Gene Genie - The Traitorous Geneticist

Sorry for the bad chapter title. I wanted to use that for a very long time.

So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.

Rev head

If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting.

Traitor

Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.

If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".
Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn doorjack, stick ID and PDA in your backpack. For added stealth, get a different outfit. doorjack your way to the captain's room, get his hand tele, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.

If you have to kill someone, same stuff from rev.

Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.

Changeling

You can DNA sting humanized monkeys to quickly gather stored genomes.